Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|393131.3.peg.2220 Phage antirepressor protein / Antirepressor [Bacteriophage A118] [Listeria monocytogenes J2818]
atgtcaaatttacaagtaattgcaaatgatatgttgccagttttagaaaatgaaaaaggc
gagaaatttgtaaatgcacgggaactacatcaaagcttgcaagttggaaaaaaattcact
acttggattactgacaagcttagtaattatagattttcaaaggatgaagactatttcccg
attttgggagaaagtacattcggtagacccagaacagaatacttattaactttagacact
gctaaagaattagcaatggtacaaaacaatgaaatgggtcgagcaattagaaaatacttt
attgaagtagaaaaacaagcgaggaaattagcaactgaatatccaacattttcatacatg
atagacgacccagtcgctagggctaaaaaatggattgaggagcaacaagagaagcaagaa
gcattaaatcaaattgaggaacaaaaaccgaaagtgatttttgcagatgctgtacaaacg
agcgagaatacagttttagtaaaagacttagcgacaatccttaaacaaaatggcttagat
attgggcaaaacaggctttttgaatggctaagaggaagcggatatttgctaaataaaggg
acttattataacaagccatcgcaaaaggcaatgaatttaggattgtttgaacaaaaaaca
catattcatacagatagaaatggcttaatgataactacctatacacctcgagttactggc
aaaggtcaaatatacctattaaacaaattattagaagaacacaatcaagtcataatttaa