Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|393117.11.peg.1627 Protein gp43 [Bacteriophage A118] [Listeria monocytogenes FSL J1-194]
atgtttcaaaaatcaacatatgcacaaaatgcgatgcgagttttagcagaaactcattcg
caaaaagaactagcgatagacagctatgtaaccgccgctttaataagtaatcaagcaaaa
ggaaagcgtacagtttcacttgaacaagcagaacagttaattgatagctataacgaacca
gaaagcacctatttattcgcacatgaattttcaaacggaatgatacctccacttttcgac
ggcttagacaatcaccacgcttctttaactaaccgttttgaactagaagttgaagaagca
ataaacacgctaaaaaatggcttagaaacgatgacatatagcttaagaaaaggtgacatg
ttacaacgagaagcagctaaacaagctatttcagaaataacagatgtagttgcatctgca
ttaactctgaacgcaagtattgcgaaagctttcaacatagatttacaacaagttttaaac
aaacgtgatcaatattatcaaaaatctggactagtaaggagttgcggaaaatga