Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|391037.6.peg.3821 Prophage antirepressor protein [Salinispora arenicola CNS-205]
ttgcggacggtcacggttggcaatgagccgtggttcgtcgctgtcgacgtgtgtagggca
ctggagatcggcaacccgcgccaagcggtgagctacctcgacgacgatgaggtgcggcag
gcacccgtcactactgatgacgggtcggaccgggtgctcatgacgaacgtcgtcagcgag
gccgggctgtactcactgattctccgtagtcgcaagccggaggcgaaggcgttcaagcgc
tgggtgacccacgacgtgttgcccgcgattcgggcgacgggccggtacgagtcggtgccg
gcggtgccgcagtcgtacgcggatgcgttgcagcttgccgcggatcaggcccggcagctt
gacgcgcaggccgccgagttggcggaggccgcgccgaaggcggcgtcgtgggacaccctc
gcctcggcggagggcgactggtccgtgcgggacgccgccaaggtgctatcgcgcgatccg
ggtctggacctcggggagcgacgcctgttcacggttctcggcgagcagcagtggatctat
cggcagcgtgctgacggtcgttggcggccgtaccagcgggcgatcgagtcgggctggctg
tcggagctgccctcgacgcactaccacccgcgcaccggtgagctggtgctcgatacgcct
caggtgcgggtcaccacccggggcctgcatctgctgcaccgccggcttggcggtacgcag
ccgttgcggacgcatgagcagacggcgctgatccagtga