Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|387910.2.peg.9 Phage antirepressor protein [Siphoviridae Staphylococcus aureus phage phiNM4]
atgcaagcattacaaacaaaatcgaacatcggagaaatgttcaatattcaagaaaaagaa
aatggagaaatcgcaataagtgcaagagagttatataaagctttggaagttaaaaagcgt
tttagcgcttgggcagaaattaacttgaagcatttcaaagaaaatagggattttacaagt
gtacttacaagtacggttgttaataacggagctgtaagacaactagaagattatgcttta
acacttgatgtagctaaacatgttgcgatgatgtcaggtacagaaaaaggttttgatttt
agagagtatttcatccaaattgaaaaagcatggaacagtccagaaatgattatgcaacgt
gctttaaaaattgctaacaacacaatcaatcaattagagacaaagattgaacgtgataaa
ccaaaaattgtatttgcagatgcagtagctactactaagacatcaattttagttggagag
ttagcaaagatcattaaacaaaacggtataaacatcgggcaacgcagattgtttgagtgg
ttacgtcaaaacggattccttattaaacgcaagggtgtggattataacatgcctacacag
tattcaatggaacgtgagttattcgaaattaaagaaacatcaatcacacattcggacggt
cacacatcaattagtaagacgccaaaagtaacaggtaaaggacaacaatactttgttaac
aagtttttaggagaaaaacaaacaacttaa