Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|370552.3.peg.1356 Phage antirepressor protein [Streptococcus pyogenes MGAS10270]
atgaataatcttatcacagtaacactaaacgaaaaccaagaacctattgtttctggtcga
gatttgcatcaagcattagaaattaaaactcagtacacaaaatggttagaacgaatgtct
gattatgggtttgaagaaaatgaagactatgtagctattagtcaaaaaagactaacagct
cagggcaatcaaacagaatatacagaccacgttctaaaactagacatggctaaagaaatt
gcgatgcttcaacggaacgaaaagtctaaacaagtccgcaaatactttatccaaatcgaa
aaagacttcaacagccctgagaaaatcatggcaagggcgttactgatggcggataagaaa
gtgcataaacttgaagcacaaatcgaggcagaccgtcccaaagtactatttgctgatgct
gtaagtgctagcaaatcatcttgtctgattggtgagttagctaaaatcctgaaacagaat
ggagtcaatattggtcagaataagctatttcagtggttacgagccaacggctacctaatc
agtcgccgtggtgagtcttggaatcagccaacgcaaaaaagtatgcagcttggattgttt
gaactcaaaaaaacagccatcaatcactctgacggtcacactacaacaaatgtaacccca
aaagttactggtaaagggcaacaatactttattaataaattctttaaccaggaatatctg
ccagtttag