Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|360109.10.peg.845 Phage antirepressor protein [Campylobacter jejuni subsp. doylei 269.97]
atgaatttagaaatatttaaaaaagatgatttacaagttagagtgataaaagatgaaaat
aatgagcctttgttttgcttaaaagatgtgtgtgatgttttagagcttacaaatagtaga
atggtttcagaagcggtaaaaagggaatttgaagatgatgtaagtttaacttaccccatc
caagatagcttaggaagaatgcaaaatgctacctttattacagaaccacaactttactat
gtaatgaataatagccgaagtaaaaacgcgaaaacttttagaatgtgggtaaataaagaa
gtcttgccaagcattagaaaaaaaggttattatagcattaatcaagattttcatcctgat
tatgatattgtcaaaaaacaaaatgacatattaaatgaaatggtttgtactcaaaataat
acaatctataatttaaaagaagctataaaagtattaaacacttctgttcaaactttaaaa
gaagttaacaaattcaaatcaaatgaaaatatcaaaaaagagtatgacacaaataataat
ccctctgaactttactcagatcttagaaagctagttaatactttagcatctaaagctaat
ggtgatcatagaaatatttggaaagatgtttattcagagcttgccaataattttaatatc
aagaaaagaattcaggttgatgatataaaaaaagataaagcttatttattgcacttaatt
gactacttaaaaagaaaaatagaatgcgaagttatttaa