Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|351745.7.peg.2304 FIG01061737: hypothetical protein [Shewanella sp. W3-18-1]
gtgaacatgtttaattatatttttgagggcaaaacttacactgacacatcaaatgaatac
atgttggcaatcggcatgagtgctgaacagatcgagtcagtaatgagtcaaaaggcatac
gaagaaggagaaggtgccatcgcaaaaagaaaggctgcatacacaaaagagtcagacccg
ttatttttagagtggcaatacgataagacgcccgctacagaagcaaaatggcgagccaaa
gtgctagaaataaaagcaagattccctatggtatcagccgatgcttag