Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|334413.6.peg.1188 Phage antirepressor protein [Finegoldia magna ATCC 29328]
atgataagtaatctaaaaacatttgaaaataagaattttgggaaactcactgttattgaa
aaagatggtgagtttttctttatagcaaatgaagtagcaactatgctaggatatgtcaat
cccagaaaagctatttatgaccatgtagacgaagaagataagggtgtaacgaaatggaac
acccctggaggaatacagaatatttcaataattaacgaatcaggattgtattcacttatc
ctctcatcaaaactaccacaagcaaaaatattcaaagcttgggtaactagagaagtctta
ccaagtattagaaaaaacggaggatatatagtagggcaagaaaagaaaactaatgaagat
ctacttgcagatgcaattcttgtagccaatagaattattgctgaaagagaagaagaaatt
gaagaattaagaccaaaggcagattattatgacaaattagtagattataacctacttaca
aactttagaaatactgccaaagagttaggaataccacaaaatcaatttataagttttcta
atggataagggattaatttacagagataagaaaaagaaactcttaccttatgcagataag
aacaagggatattttgaagtaaaagaatggattgatccactaggtacacttgtaggaata
caaacattaataacaccaaagggaagacactacctactaattttattagatagtgaaggt
ttctacgatgaataa