Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|324831.13.rna.20 tRNA-Pseudo-??? [Lactobacillus gasseri ATCC 33323]
agcaacttagttcaatgggagaacaaagcgtgtacagttaaacaatgtgcttgagaaggt
ggttcgattccatcagttgctg