Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|324831.13.peg.644 FIG00751351: hypothetical protein [Lactobacillus gasseri ATCC 33323]
atggcaattgagttaaagattggggctagaggaacgagagaagattttgaagacacatat
actagaagtttcttagaagataacggtctgtttaaatttgatccaagaaagtttacagtt
aactgtgtgtggggagttcatactaaatacggctatatgtgttctttcagttatgatgac
attttgacatacatgggcgatggtgtctgggacttaagagtagctgaagaaacaaaaata
actgatgaagagttgaagagagcattatcagaacctgacaaggagttctag