Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|324831.13.peg.632 FIG00744143: hypothetical protein [Lactobacillus gasseri ATCC 33323]
atgggtagaagaatgtacagcgataagattgttgaaactgataaattcttagatatgccc
gtatctagtcaaaatctatattggcacttatgtatgcacgcagatgatgatggattttta
ggaaatcctaaaactatagttagatcaattggtgcacaacaagacgatttaaaaattcta
gttgaaaagggatacgtaattgtatttgaagatggagtaattgctataacagactggttc
gttcataactacattcctaaagatcgctatcatgaaacagtttataaagaagataaaaaa
caacttgagctgtccgaaaccaagcaataccgccttgttacaagaaagccgattgttcag
gatacaaaaagtaaacaagttgtagacaacatggatacatcttgtatacaagatgataac
aaagtgtataccgaagataagttaagtaaagataagttaagtaaagataataatatatat
aaattgtcgagttcagagaacatcgacaccgatccagaacaaaaatctcaaaaaatacct
tacgaaaaaattatcgattacttaaacagaaagactaattcacattatcgtccaacttct
aaagctactaggcgactaattaaagctagatacaacgagggctttactgatattgacttt
aagtctgttatagacaagaagtgtgctgaatggctacaagatggcaacatggttcagtac
ttaagaccagaaactctttttggaactaagtttgaagcatatctaaatcagccagataca
ggacctattccacgaaacaattttagaaataagccagttcgaagggctacaaactgggat
aaggttcagcaacaacaatcgcaaacaacactacaaatgacgcgagaagaacgtaacgca
attttcagagagtacgggaggtaa