Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|323097.6.peg.3318 hypothetical protein [Nitrobacter hamburgensis X14]
atgtccgactccatccgccttgcccgcaccgatacctacgagcacaccatttcgggcttg
ctcaaaaagcgcgccgatctgttcaacgaagccgagcgcatccgcgatcgaatggccgaa
atcaaaaacgacattagcgcgctggatcgggtgctagggacgctcggttataccggcgat
ctggacgccgaaatgccacgccagaagcggcaagtcctgttcgggcgcggagagctaacg
cgggcgattttggacgagctacgggatgcgccgcgaccgttaggaagccgagagatagct
caaggaattgttgcgctgagcggtcaggacgcgcgggatcgtaagtacgtaacggacctg
acaaggcgggtcagcaaggcgcttcggatgctcaaagagagcgggtcggtacggtctctc
ggggattgcaagggtaatttgcgatggacgttgcagtcttga