Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|299033.6.peg.788 transcriptional regulator, XRE family [Lactobacillus reuteri F275]
atgtccataggtaatagaatagccgatttaaggacaaataatcatatgtcacaattccaa
ttagcaaaagtattaggaattggaacaagcactttaggaatgtacgaaacgaataaaaga
aagcctagccctaaagtcttaaataaaatagctgattatttcgatgtttctactgattat
ttattagggcgcaagagtaaagcagatcaagtacataatgcgactgttgatgaagctctc
ggaacaattatgtcattcgaaggccaacccgttactgaacatgataagaaagtaatgaaa
gatttactagaaagttatctcagaaataaagagtaa