Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|293826.6.peg.878 Phage antirepressor protein [Alkaliphilus metalliredigens QYMF]
atgaataaacagctgcaggtttttgaaaaagaagaatttggacaagtaagggttttgagg
caagatggacagccttggtttgtaggaaaagacatagcagatagcttggggtataaaaat
ccaagcgatgcacttttaaagcatgttgatgaggaagacaaggcactcgcgaaatgcgat
acccttggtggcacacaacaaatgacgattataaatgaaagtgggttgtacggtttaatt
ttaagttctaagctgccaaatgccaaaaggtttaagaggtgggtgacatctgaagtgcta
ccctctatacaaaggcatggcgtttatatgacgccagacaagatagaagaagtgttattg
aatccagatatgataataggccttgccactaagctcaaggtagagcaagagctcagtaaa
aaacagcaacagatcataggggagttaaagcctaaagcggattatatggataaaatcttg
aaaaataaaggacttgtcacaatcacacaaatcgctaaggattatggaatgagtggacaa
gcaatgaatgatttattacatagcttgagggttcagtataagcaaagtgggcaatggctt
ttatatagagctcatcatggaaggggctatacccactctgaaaccattgacatattaaga
agtgatgggaatttagatatcaagatgaacacaaagtggacccagaaaggacgattgttt
ttatatgacttgttgagagaacataatatattgccaacaattgaaaaagccccattggct
gcaaccaataggggcatagaaaaacaattcatagttagtatatcaatttga