Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|264731.4.peg.1909 Phage antirepressor protein [Prevotella ruminicola 23]
atgtttgtggctaaggatgttgccacagcattggggtatactaataccccgaaagctatt
cgcgaccatattgacgacgacgataagctgaccgaacgattcgttctgtcaggtcaagtt
cgaagtgtcatcatcatcaacgagagcggactttacgcactcatcctctcatccaagctt
ccacaagccaaggcctttaagcactgggttaccagcgaggtgctgccacagattcgccag
acgggcggttacattccaacccgcgctgctgatggccgcgacctttctgccgttgaaatc
ctgcaccgagccgatgcgattgttggtaacaccttgcgcatgctgaacgagcccgccgag
gatacactgacggctacgcaggtggccaagacgtttaacatgactacctacgactttaac
gccattctgcgcgacatgggcatacagtaccgccgcgatgggcattggaacatcagcgac
gatctggccgaccgcaaccttacacgcctgcgcacgcacgtatcctatagtttaaagggc
cagaagaaagtaaaggtttatatgacctggacccttgatggcgtgagattccttaattct
aaacttggttatcctaatttctaa