Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|257314.6.peg.318 Lj965 prophage antirepressor [Lactobacillus johnsonii NCC 533]
atgaagatgaataacgaattacagctattcgactttgaaaacaatcaaattagagtttta
aaaatcaacaatgagccatggtttgttggaaaagatttagcaaatgttcttggatattct
aatactcaaaaagcgattagagatcacattgatccagacgatttaaggggtgaacgaatc
gttaccccctctggaaaacaaatgacaattattactaatgaatctggaatgtacagttta
attctttctagtaaattgccaagcgcaaagaagtttaagcgttgggtaacaagcgaagtg
cttccagcaattcgagaagatggagcatatattactgacaataaggctatgcaattgatg
agcgatcctcaggagcttggcaatttcttgttaactattggcaatagagttaaggcatta
gaagctgagaaaaaagagcttaaagacaccaatgcaaaacaagcagcaaagattgctaga
gatgctgatgatgtggtttttgctaaggctattaggtatagccatcatgcaattcctgtt
ggcgaattagctgaaattttaactcaaaacggttttgtgattggaagaaatcaactattc
caattacttagagaagaaaaatatctttcaagttttaatcatagctggaacgtgcctatg
acacagatggttaaaagagggctatttagaattactcataatttgaccagagatggcaga
ggatattctcaaacatgggtaacgcctaaaggtcagaaacacattattaacaaagcgtta
agaggaagatttgatgatacttatcaaaaagttatggtatcaactttgaacgtttag