Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|257309.1.peg.173 Phage antirepressor protein [Corynebacterium diphtheriae NCTC 13129]
atggaattaaaaccatttaatttccgtggacacaatgtacgagtcttagttgcagagaac
ggggagccgctgtgggtaggacgagatgtatgtgcagttttagagatcaaaaactctagg
gatgcactatctcgtatcgatccagagggggtcggcattgccgacacccttacaccagga
ggtatacaaaagctcaaagtcgtaaatgaatcaggattatacgaactccttttccagtct
cgcgtacctcaagcaaaagaattccgccggtgggtaaccggagaagtcctgccagaaatc
cgtcgccacggcatgtacgcgacaaccgcaacggtagagcaaatgctcgctgatccaaca
acagcaatcaaacttctggaacagattaagcaagagcgcgaccagcgccgggcgctcgag
gtgcaagctgcgattgataaaccaaaggtcatgttcgctgatgctgtcgcggaagctaac
actgacatcttggtacgtgacttagcgaagatcttgcgcggcaatggtattgaggtcggc
ggaaatcgtcttttcgcgtggcttcgaaagcacaaatacctcatggacgggccaagccac
attaagcacacaccaacacaaaaagcgatggaactcgggctgttcaaaatcaaagaaaca
gtggtgaccagatccgacggaagatcatcgatcaccgtaacaccgaaggttacgggaaaa
gggcaacgatatttcgtcgagaggttcctcgatgggcggttcgacatcaatgacatcaag
acaaataaaaaccgacctgttgcagcaggtcggaaatga