Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|216895.1.peg.2315 Prophage antirepressor [Vibrio vulnificus CMCP6]
atgtttgatgttttgctttatccaagttctatgggagaacttgaaataaaaaccatgcaa
aagggtggggatacgctgttccttttacctgatgttgttcaagttatttcacaagagact
cagtctctagatggcagggcaacttcgaatcaagcatccctattgaaagctagcattaca
tcattagaagatgatgagcgatttattgagactgtgattgttgatggcaaggaagagcgt
cattactacgttactgagccgggtgtataccgagtggcaatgcaagcaaaaagctctgga
gcgaaaaagtttcaaaattgggttttaaaagaagtaatgccatcaatccgtcgatttggt
atttatccgcctccggaagtaaacgatgacgactttctattgcaagtagcagatcaacaa
gcaaaacagtctcagttactgagccagtttatgcgtagctctatggaaaagttcaagcat
ttggacaataaagtggatgagcaatcagacactattaagcttcaaggttctgttttacag
tccctaaaagaaaggttagataccgtagagcttaataatcactcaaaccttgaatatttt
gatgttagcgaagtcatcaggtccctagagatagatgagagtaaattgactttagttgtt
gctcaatgtgaaaaagttgcctcagaaaaaggttcaattatcaagtctcgctcagcggta
tacgagaagagcagcgttttcctatggctgttataa