Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|216591.1.peg.1896 Antirepressor [Burkholderia cenocepacia J2315]
atgaacaatggcctactttcattcgatcacgatggcgcaaccattcgcacactaactgtg
gaaggcgaaccatattttgtagcccgcgatgttgccgaaatactcggttactccaactac
cgcgatgcgattgcacgtcattgtaagggcgtcgtgaaacacgacacccctaccgtggga
ggaatgcaggaactaacttacatccccgaacgtgacgtttaccgattggtgatgcgctcc
aagcttccgggcgctgaacgtttcgaagaatgggttgtaggcactgtattgccatcgatc
cgcaagagcggttcctatgcagttcaaccggctttcgaaaccccgaggacacttgtagag
gctctacggctcgcagcggaccttgaagaaaagcgtgcagcgttagaggttgagaacaag
catcaggcgcaattgatcgagtatcacaaaccggacgtgcagtttgcagaagctatgcgc
gcatctgaggacttggtagatattcctacagttgccaagacactttcaaagataaagccg
attggacctatccagcttgcgcgtgcgctgaaagaatgcggaattttccgaaaagaccat
aaagaaaatctgcctatgcagaagtttgttaatgcggggttcttcactgtgattccgtca
acttggaccgctccggacggcgcagttaaaacgcattacaaagtgatggtgacaggcgca
ggtttgcagccgctaacggattggtacgtgaagtacatcgaaactctcccgcccacactc
agcaagaagcgcaaataa