Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|216591.1.peg.1893 [Burkholderia cenocepacia J2315]
gtgttgccatgtctatgcctgctgtggcttccagtgagcgtagtcgctacgggccgaata
gaactcttcatgccgcaccacgtgaagacccggatgcaatgcctcaacttgagctttcat
catgtcgttttgtacggcgacccccaagaagtacgccgctggaacgccgtccaacatcaa
tacctccgcctgtgggttggtcggaaactggtctgcaagatgcaggttcgcgcggacttt
atcatcaaagtccccatacatggcttggaacgcaggcaacccggttcgctggtcgagggg
gatagccgataccctgcctgccgccgcatttgtaatgcaaaacgcacatcgcaatttcca
aagcgcggatgggtcaattccgacgactacccaattctcgccccgattttcttggcgata
acggtagaacattctgtagttcggaaaaccgatggacacacataccgcgtcagtacgatc
aagcctatattgatcgttcacagcaccaataacattccggccatccagccgattacgaca
taccaacccgtgcgcaaggatcgacgcgaggttagagagtctagtgaaatgcaccaaata
cttgatacctctttcggccgcaaactcttgtattgttcttgctaccatcatgcccccgag
catatttggtctgaatatttttgctttcagtgcctaatatacctcagttga