Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|208435.3.rna.91 tRNA-Arg-CCT [Streptococcus agalactiae 2603V/R]
gtccccttagttcaatggatataacaactccctcctaaggagtaattgctggttcgattc
cggcaggggaca