Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|208435.3.peg.563 Retron-type RNA-directed DNA polymerase (EC 2.7.7.49) [Streptococcus agalactiae 2603V/R]
atgattgctcagaaagctataaacatctttgaaaaggttcaagtatttcaacggaagata
tatctatcgaccaaggcagataataagcgaaagtttggtgttttatacgacaaagtatat
cgtaaagatatcctgaaagttgcgtggttctatgtaaaaaggaataaaggttcggcaggc
attgatgacttcacgattgaagaaattgaagcctacggtgtacagaaatttcttgatgaa
atagaagaccagttgagaaacaagaaatatcaacctaaggcagtaaagcgagtttatatt
ccaaaagcgaatggtaaaaagagaccgttgggaattccgacagtccgagatagagttgtt
caaacagctgtgaaaatagttatagaaccgatattcgaagcggactttcaagaattttct
tatggttttagacctaagcgaagtgctaaccaagctataagagagatatataaatatctc
aattatggttgtgagtgggttattgatgccgacttaaaaggttactttgacacgatacct
catgataagttactacttttagttaaggaacgagtaactgataagtctattatcaagtta
cttagtttatggctagaagcaggtatcatggaagacaatcaagtgagaagtaatatttta
ggtactccacaaggaggtgtcatatcaccgttgttagcgaatatctacctaaatgcttta
gacagatattggaagaacaatcggttagaaggaagagggcatgatgcccacttgatacgt
tatgcggatgactttgttattctatgctcaaataatccgaagaaatattatcagtatgcg
aaacagcgtattgataagctaggattaacattgaacgaagaaaagacaagaattgtgcat
gcgacagagggatttgattttctaggctatacgcttaggaaatcaaaatctcacaaaagt
ggtaagtataaaacctactactatccttcaagaaaatctatgaaatcaataaaaggcaaa
gtaaaagatgttatccaaacaggacaacacctgaaccttcctgatgtcatggaaagattg
aatccaatgttgagaggatgggctaattatttcaaagctgggaactctaagcaacacttc
aagagtatagataactatgtcatatataatctaacaattatgcttagaaagaagcacaag
aagtctggaaagggatggagggaacatccgccgtcatggtactataactactttggactg
gtttgtttaaggaagttgagtaccaatatcaatgatgatagtcagagatatggtagataa