Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|208435.3.peg.560 hypothetical protein (phage associated) [Streptococcus agalactiae 2603V/R]
atggcttatttatacgaattagaaggtatttacgcacaattacagtcaatggatttagac
gaagaaacattccaagatacacttgacagcattgattttcagtcagacttagaaaataac
attgagtattttgtcaaaatgttaaaaaatgtgcaggctgatgctgaaaagtataaagcc
gaaaaagaagctttttataaaaagcaaaaacaagcggaagccaaagcggaaaaatacaaa
gagacgatcaggcttgcaatggaattgagtcaaaagaaaaaagttgacgctggaatgttt
aaggtgtctttgcgaagaagtaaaaaagttgagattttggacgaaacaaaaattcctctt
gattacatgcaagaaaaaattgaatacaaaccaatgaaagctgaaatctcaaaagctttg
aaatctggaattgatatatctggagttgaactaatcgaaacagaaagtttgcaggtaaag
taa