Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|198466.1.peg.1261 Phage antirepressor protein [Streptococcus pyogenes MGAS315]
atgaataatcttatcacagtaacactaaacgaaaaccaagaacctattgtttctggtcga
gatttgcatcaagcattagaaattaaaactcagtacacaaaatggttagaacgaatgtct
gattatgggtttgaagaaaatgaagactatgtagctattagtcaaaaaagactaacagct
cagggcaatcaaacagaatatacagaccacgttctaaaactagacatggctaaagaaatt
gcgatgcttcaacggaacgaaaagtctaaacaagtccgcaaatactttatccaaatcgaa
aaagacttcaacagccctgagaaaatcatggcaagggcgttgctgatggcggataagaaa
gtgcataaacttgaagcacaaatcgaggcagaccgtcccaaagtactatttgctgatgct
gtaagtgctagcaaatcatcttgtctgattggtgagttagctaaaatcctgaaacagaat
ggagtcaatattggtcagaataagctatttcagtggttacgagccaacggctacctaatc
agtcgccgtggtgagtcttggaatcagccaacgcaaaaaagtatgcagcttggattgttt
gaactcaaaaaaacagccatcaatcactctgacggtcacactacaacaaatgtaacccca
aaagttactggtaaagggcaacaatactttattaataaattctttaaccaggaatatctg
ccagtttag