Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|195102.6.peg.1185 FIG00523724: hypothetical protein [Clostridium perfringens str. 13]
atggggattttagaagttttaacattaatatttatagtattaaagctatgtggagtaatt
gcttggacttggtggttagttttattaccagagattataggattaatattatactttata
gttgggataggaattacaattacaggaaagaaaattagtagtaagaaaatggaggattaa