Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|186103.3.peg.1131 putative antirepressor - phage associated [Streptococcus pyogenes MGAS8232]
atggaattacaagtatttactaatgaacagtttggagaagtgcgtacagcagatattaac
ggagaatcgtttttcaatttgaaagactgctgtaaaattttagaaatcaaaaatagcaaa
gatgttgttaaacgacttaacccaaagggggtcgttactaccgacctccttacgaatggc
ggaactcaacaagctaacttcatcaacgaaagcaatttctacaagttagtcttccaatct
cgcaagccagaagctgaaaagtttgcagactgggtcacatcggaagtcctaccatcaatc
cgcaaacacggcgcttatatgactgaacaaaccttggaacaggcacttaccagcccagac
ttcctcatacggcttgccaatgagttaaaagaggaaaaggagcgcagtcgtcagttagag
gctgagaagtcaattttgagcgttgagaacatggttatgaagccaaaggctgattatttt
gatgatttggttgaccgcaatttattgactagtttccgtgaaactgctaaacaattaaaa
gttaaggaacgacgattcattcaatttctacttgataagaaatacgtttacagagacaag
aaaggtaagcttatgccgtttgcagataaaaatagcgggttatttgaagtcaaggaaagt
gttaacgaaaagaccaactgggcaggaactcaaaccttaataactccaaaaggtcgtgaa
acttttagactgttatttatttaa