Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|155920.4.peg.4086 Phage DNA-binding antirepressor protein Roi [Xylella fastidiosa subsp. sandyi Ann-1]
atgaacgaacttatacagaaagtaagcgatgcggcgatcacaagccgtgaaatcgcccag
ttagtggaatccaggcacgacaacgtgcgtgtaacgattgaaaggttgtccgaacgcggt
gtgattgctttacctgcaacgcaggaaaagcccacaggtggacgaccgagcatcgaatac
gttttcacgggtgaacaaggcaaacgagacagcattgtagtggtggcccagctttcaccc
gagttcacagccagactggtagatcgctggcaagaactggaaacagagctaatccaaaca
cgttttgtcattccgcaaacactgccagaagcactccgactagcggcagacttggctgac
aagaaccaggcattagaaaaggtggtggcagatcaatcccccaaggtgctgacccatgat
cggattgcagcagctgatggatcactgtgcctgcgtgacgctgccaaggtgttacagatg
cgcccgattgacctgcgtcattggttaatcgttaaccgctggatctatggcagacccgga
catagtgggtggcttgcctatcaacatcgcatccagcagggcgtgatgtgccacaaagtg
accacagtccaacgtgaagagggcaccgacaaggtgattgagcaagcccgtatcacttca
aagggcctgaccacaatcagtcatgaactcacgaaagcaccattggtcgcgtga