Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|155920.1.peg.1953 Phage antirepressor protein [Xylella fastidiosa Ann-1]
atgacgcagttaccctctgccgtgtgtttttccggcaaatccctttccattatcgaccgt
gacggtgttcctcacctaagcgcacgcgatctagcccacgctttgggttacgccgatgaa
cgatccgtattgcgcatctacaaccgtcattccgaagagttcacctatcaaatgaccttg
gtggtcaatttgaccaccgttaccggagacaaacccacccgactcttcaaccctcgtggc
tgccacatggtatcaatgtttgctcgcacttcagttgccgccgcgtttcgtcgctgggtg
ctggatgtgttggaattcatgccctcaatccgcaagacgggcagctactcggcttcgcac
cctcctgctgtcactttgacagaagaagaggcattcaacctgtacgcactgctgaggatg
gtcgcggggcatttgtcacgggaacgcattgagccgattgaacaagccttacatctgatt
cgctcaccgttagccggtgcggtcagcgatttgtggcgggaggtggggccgcgcgctaag
cgcatggagaacctcgctgggcgttgccgcaatgccttctaccgtttgcgctaa