Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1261557.3.peg.1857 Phage antirepressor protein [Enterococcus faecalis str. Symbioflor 1]
atgaacgaactaattaaagttacaacaaatgaaaatgatgaacagttagttaacggtaga
gagttatatgaatttctgggagttaaagataattatactgattggtttaaacgaatgatt
aaatacgggtttgatgaaaacgttgattttatcagtttctcggaaaaatccgataaacct
tttggtggtcgcccacaagtaaatcattatgtgaaactagacatggctaaggaaatttca
atgctacaacgtaccgaaagaggaaagcaagctcgtagatattttattcaactagaaaag
ttttggaatagcccagaaatgctgactaaacgagctcttgaatttcaacagaaaaaaata
gaagtattacaactagaaaatgaatcattaaaacctaaagcattatttgcagatgccgtt
gatgcaagtaagacttccattttaatcggtgacctagctaagctaatcaagcaaaacggc
atcgacattgggcagaatcgtttattccaatggctgcgagacaatgggtatctaattgct
cgaaaaggtgaaagctacaatatgccaacccagcggtcacttgatttgggaattgcggaa
atcaaggaacgaacccataacaatccagatggaagtattcgaattagtcgaacgccgaaa
attactggtaaagggcaaatatattttgttaacaagttcttacatgacaagacagcatag