Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1220510.3.peg.741 Phage antirepressor protein [Staphylococcus epidermidis AU12-03]
atgcaagcattacaaaaaattcaaattgaaaacaactcagaagtaggagcagttgtttct
agtcgagtgattgctcaagaactagaaaaaaaacacgctcatgtaattagagatttagaa
aaaattttactcagcccaaatgtgggttcagtaataattcctaacgaatataaagatagt
actggtagaaaattgaaagaatatttactaacaaaagatggtttcactttatatatgttc
aacattcaaggtcataacgatttcaagatggcgtatatcaataaatttaacgaaatggaa
aaacaactcaaacaacctgttgcaagttacatgatagaagatcctgtaagacgtgctgag
aaatggattgaagaacagaaagaaaaagaaaagttgcttgagcagaactcaatacaacag
caacaaattggcgagttaaaacccaaagctgactatgtggacgaaatattaaaatcaccc
ggaacgatgactatcacacaaattgcagctgattatggtttgtctgcacaaaagcttaat
aaattattacatcaagcgagattacaacgtcgtgtaggtaaacagtgggtgctatacatc
gaaaatatgaacagaggatatacaaagtcgcacacaattgaaatagtccgttcatatgga
catccggacactcaaccacagacgcgttggactcaaaaaggcagattaaaaattcacgaa
atcatgactgattttggttatgaagcagaagttacggaggtatga