Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1165952.3.peg.810 Phage DNA binding protein Roi [Escherichia coli O26:H11 str. CVM10030]
atgaatgagttaataaatggcaatgccatcaaaatgacaagcattgaaatagctgagttg
gtgggtaagcgtcatgacaatgtgaaacgtaccatcgaaacgctggctaaaaatggtgtt
atccggcttcctcaaattgaggtttccgaaagaatcaataacttagggttcaatgttcag
tacgagcattacgtcttcgagggcgaacaaggtaagcgagacagtattgtcgttgttgcc
cagttgtcgccagagttcaccgctcgtcttgttgaccgttggcgagagcttgaagaaact
gcggttaatatccccaaaacgttaccggaagcgttgcgccttgctgctgatcttgctgag
cagaaaatgcaactggaaaaccagctcgcaattgccgcacctaaagttgagtttgccgat
cgcgttggcgaggccagcggaattttgattggaaactttgcaaaggttgttggtattggt
ccaaacaaactgtttgcgtggatgcgcgatcacaaaatccttattgcttcaggttcccgg
cgcaatgtgccaatgcaggaatatatggatcgcggctatttcacagtgaaagaaacagcg
gtcaacacaaatcacggaatacagatatcgttcaccacaaaaatcaccgggcgtggtcaa
cagtggctgaccagaaagctgctcgataacggaatgctgaaagtaacaggggaggctgct
taa