Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1157453.3.peg.2310 Phage antirepressor protein [Enterococcus faecium UAA714]
atgaacacaccacaaattttcaatttcgaacaaaacgaagttcggacgtttctagaaaat
gacattccgtatttcgtagcaaatgatgtcgctaaaacattaggatacaaaaacccgagc
gatgctactaataaacattgtaaaaaagccgtaaaaacatggggtagcgattcgctaggt
cgtcgccaatctttcaaagttattccagaatcagatgtttaccgcttgattatcaaatcg
aacttaccaagcgctgaaaaatttgaggcttgggtaatggaagaagtccttccaacaatc
agaaaaacaggtagctattcaaatgtacctcaaagttttgcacaagcattgcgtttagca
gcagatttagaagaaaagaaccaattactcgaacaacaaattgccgagtacgaaccaaag
attagctacttagatacgattctttcatcgacagatacggtagcgacttctcaaattgca
gctgattacggaatgtcggcaattgctctaaacaaattgcttaacgagttaggtgttcaa
cataaagttagcggacaatggatactttaccgaaaacatatgaaccaaggatacacaaaa
tcgcacacaagtgagattccgaaagccgatggcggcactaaagttgtaatgaataccaaa
tggacacagaaagggcgagtgtttatttacaacttattaatcgcagagggctattaccct
caaatggatttagaggaaatttgttag