Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1155766.14.peg.1506 Phage antirepressor protein [Enterococcus faecium Aus0004]
atgaacacaccgcaaatttttaatttcgaacaaaacgaagttcggacaattttagtaaat
gatgaaccatattttgtaggcaaagacgttgcgagtgttttgggttattcaaacactaaa
gatgctttgtcgcggcatgtagatttggaagataagatggggtcgcgaatcacgacctca
ggtcaatcaagagagatgacaatcatcaacgaatctggtttgtacagtttaatcttaaaa
tcaaaacttccctctgccaaaaaatttaaacgttgggtaacaagtgaagtgttgccagca
attagaaaacatggaggttatctaactccagaaaaagtagaagaagctttgcttaatcca
gatacaatcattcaattagcaactcaactaaaagaagaaagaactggaagattaatcgca
gaacaaaagattgcagagtacgaacctaaaatctcctatttagatagcatattatcttct
acagattcagtaacaattagtcagattgcagcagattatgggatgtctccacaacagatg
aataaattacttcataaactaggtattcagaaaaaagtcggtaaccaatggttattgtgc
aaaaaacacatgaaccaaggatacacaaaatctcatacaactgagatcccgaaagccgat
ggtggcactaaaattgtaatgaataccaaatggacacagaaagggcgtctatttatctac
gaattactaaaaaaagaaggatattaccctcaaatggatttagaggaaattggttag