Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1154904.3.peg.416 Phage antirepressor protein [Streptococcus agalactiae GB00174]
ttgagaacagaaacatggaatggatatgatatccgatttgtagagcaccaaggcgaatgg
tgggcagttcttgctgatatttgtcacgcgctagacttaaaaccaaaacgtgtgaaagag
cgtttagttgatgaggtcgtttcaaccgaccacgtcgcagacagtttaggacgtcaacaa
gaaatgctaattgttaacgagtttggaatttatgacactattttttcaagtcgtaaacca
gaagcaaaatcatttaagttttgggtatttgaaaccattaaacagttaagacaagcaact
ggtctagaaggctttgaggtctttagaatgctggataaggaacatcaaaaagaagctatg
gcaagattgactaatagcttagatagggtatctaagaaagacttgattaaagctaacaca
atcacaaataaagccgtttccaacaagtttggatattcaaaaatggttaaaaaatcagaa
atgacaccagatatgttagttgctagagaaatgattttagatgatactgtggaactcatg
ggaattaaagaaaagttcggattgaatatcagtgtgtctgagtcaatctacaataaaaat
taa