Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116221.3.peg.2742 Phage protein [Staphylococcus aureus subsp. aureus VRS8]
atgccgaaagaaaaatattacttataccgagaagatggcacggaagatatcaaagtcatc
aagtataaagacaacgcaaatgaagtttattcgcttacaggagcccatttcagcgacgaa
aagaaaattatgactgatagtgacctaaaacgattcaaaggcgctcacgggcttctatat
gagcaagaactagggttacaagcaacgatatttgatatttag