Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.773 Succinyl-CoA ligase [ADP-forming] beta chain (EC 6.2.1.5) [Escherichia coli P0299917.4]
atgaacttacatgaatatcaggcaaaacaactttttgcccgctatggcttaccagcaccg
gtgggttatgcctgtactactccgcgcgaagcagaagaagccgcttcaaaaatcggtgcc
ggcccgtgggtagtgaaatgtcaggttcacgctggtggccgcggtaaagcgggcggtgtg
aaagttgtaaacagcaaagaagacatccgtgcttttgcagaaaactggctcggcaagcgt
ctggtaacgtatcaaacagatgccaatggccaaccggttaaccagattctggttgaagca
gcgaccgatatcgctaaagagctgtatctcggtgccgttgtagaccgtagttcccgtcgc
gtggtctttatggcctccaccgaaggcggcgtggaaatcgaaaaagtggcggaagaaact
ccgcacctgatccataaagttgcgcttgatccgctgacaggcccgatgccgtatcaggga
cgcgagctggcgttcaaactgggtctggaaggtaaactggttcagcagttcaccaaaatc
ttcatgggcctggcgaccattttcctggagcgcgacctggcgttgatcgaaatcaacccg
ctggtcatcaccaaacagggcgatctgatttgcctcgacggcaaactgggcgctgacggc
aacgcactgttccgccagcctgatctgcgcgaaatgcgtgaccagtcgcaggaagatccg
cgtgaagcacaggctgcacagtgggaactgaactacgttgcgctggacggtaacatcggt
tgtatggttaacggcgcaggtctggcgatgggtacgatggacatcgttaaactgcacggc
ggcgaaccggctaacttccttgacgttggcggcggcgcaaccaaagaacgtgtaaccgaa
gcgttcaaaatcatcctctctgacgacaaagtgaaagccgttctggttaacatcttcggc
ggtatcgttcgttgcgacctgatcgctgacggtatcatcggcgcggtagcagaagtgggt
gttaacgtaccggtcgtggtacgtctggaaggtaacaacgccgaactcggcgcgaagaaa
ctggctgacagcggcctgaatattattgcagcaaaaggtctgacggatgcagctcagcag
gttgttgccgcagtggaggggaaataa