Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.4543 Aspartokinase (EC 2.7.2.4) [Escherichia coli P0299917.4]
atgtctgaaattgttgtctccaaatttggcggtaccagcgtagctgattttgacgccatg
aaccgcagcgctgatattgtgctttctgatgccaacgtgcgtttagtagtcctctcggct
tctgctggtatcactaatctgctggtcgctttagcggaagggctggaacctggcgagcga
ttcgaaaaactcgacgctattcgcaacatccagtttgccattctggaacgtctgcgttac
ccgaacgttatccgtgaagagattgaacgtctgctggagaacattactgttctggcagaa
gcggcggcgctggcaacgtctccggcgctgacagatgagctggtcagccacggcgagctg
atgtcgaccctgctgtttgtcgaaatcctgcgcgaacgcgatgttcaggcacagtggttt
gatgtacgtaaagtaatgcgtaccaacgaccgatttggtcgtgcagagccagatgtagcc
gcgctggcggaactggccgcgctgcagctgctcccacgcctcaatgacggcttagtgatc
acccagggatttatcggtagcgaaaataaaggtcgtacaacgacgcttggccgtggaggc
agcgattatacggcagccttgctggcggaggctttacacgcatctcgtgttgatatctgg
accgacgtcccgggcatctacaccaccgatccacgcgtagtttccgcagcaaaacgcatt
gatgaaatcgcgtttgccgaagcggcagagatggcaacttttggtgcaaaagtactgcat
ccggcaacgttgctacccgcagtacgcagcgatatcccggtctttgtcggctccagcaaa
gacccacgcgcaggtggtacgctggtgtgcaataaaactgaaaatccgccgctgttccgc
gcgctggcgcttcgtcgcaatcagactctgctcactttgcacagcctgaatatgctgcat
tctcgcggcttcctcgcggaagttttcggcatcctcgcgcggcataatatttcggtagac
ttaatcaccacgtcagaagtgagcgtggcattaacccttgataccaccggttcaacctcc
actggcgatacgttgctgacgcaatctctgctgatggagctttccgcactgtgccgggtg
gaagtagaagaaggtctggcgctggtcgcgttgattggcaatgacctgtcaaaagcctgc
ggcgttggcaaagaggtattcggcgtactggaaccgttcaacattcgcatgatttgttac
ggcgcatccagccataacctgtgcttcctggtgcccggcgaagatgccgagcaggtggtg
cagaagctgcattttaatttgtttgagtaa