Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.4476 Phosphoenolpyruvate carboxylase (EC 4.1.1.31) [Escherichia coli P0299917.4]
atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcggcaaagtgctggga
gaaaccatcaaggatgcgttgggagaacacattcttgaacgcgtagaaactatccgtaag
ttgtccaaatcttcacgcgctggcaatgatgctaaccgccaggagttactcaccacctta
caaaatttgtcgaacgacgagctgctgcccgttgcgcgtgcgtttagtcagttcctgaac
ctggccaacaccgccgagcaataccacagcatttcgccgaaaggcgaagctgccagcaac
ccggaagtgatcgcccgcaccctgcgtaaactgaaaaaccagccggaactgagcgaagac
accatcaaaaaagcagtggaatcgctgtcgctggaactggtcctcacggctcaccctacc
gaaattacccgtcgtacactgatccacaaaatggtggaagtgaacgcctgcttaaaacag
ctcgataacaaagatatcgctgactacgaacacaaccagctgatgcgtcgcctgcgccag
ttaatcgcccagtcatggcataccgatgaaatccgtaagctgcgtccaagcccggtagat
gaagccaaatggggctttgccgtagtagaaaacagcctgtggcaaggcgtaccgaattac
ctgcgcgaactgaacgaacaactggaagagaacctcggctacaaactgcccgtcgaattt
gttccggtacgttttacctcgtggatgggcggtgaccgcgacggcaacccaaacgtcact
gccgatatcccccgccacgtcctgctgctcagccgttggaaagccaccgatctgttcctg
aaagatattcaggtgctggtttctgaactgtcgatggttgaagcgacccctgaactgctg
gcgctggttggcgaagaaggtgccgcagaaccgtatcgctatctgatgaaaaacctgcgt
tctcgcctgatggcgacacaggcatggctggaagcgcgcctgaaaggcgaagaactgcca
aaaccagaagggctgctgacacaaaacgaagaactgtgggaaccgctctacgcttgctac
cagtcacttcaggcgtgtggcatgggtattatcgccaacggcgatctgctcgacaccctg
cgccgcgtgaaatgtttcggcgtaccgctggtccgtattgatatccgtcaggagagcacc
cgccataccgaagcgctgggcgagctgacccgctacctcggtatcggcgactacgaaagc
tggtcagaggccgacaaacaggcgttcctgatccgcgaactgaactccaaacgtccgctt
ctgccgcgcaactggcaaccaagcgccgaaacgcgcgaagtgctcgatacctgccaggtg
attgccgaagcgccgcaaggctccattgccgcctacgtgatctcgatggcgaaaacgccg
tccgacgtactggctgtccacctgctgctgaaagaagcgggtatcgggtttgcgatgccg
gttgctccgctgtttgaaaccctcgatgatctgaacaacgccaacgatgtcatgacccag
ctgctcaatattgactggtatcgtggcctgattcagggcaaacagatggtgatgattggc
tattccgactcagcaaaagatgcgggagtgatggcagcttcctgggcgcaatatcaggca
caggatgcattaatcaaaacctgcgaaaaagcgggtattgagctgacgttgttccacggt
cgcggcggttccattggtcgcggcggcgcacctgctcatgcggcgctgctgtcacaaccg
ccaggaagcctgaaaggtggcctgcgcgtgactgaacagggcgagatgatccgctttaaa
tatggtctgccagaaatcaccgtcagcagcctgtcgctgtacaccggggcgattctggaa
gccaacctgctgccaccacctgagccgaaagagagctggcgtcgcattatggatgaactg
tcagtcatctcctgcgatctctaccgtggctacgtacgtgaaaacaaagattttgtgcct
tacttccgctccgctacgccggaacaagaattgggcaaactgccgttgggttcacgtccg
gcgaaacgtcgcccaaccggcggcgtcgagtcgctgcgcgccataccgtggatttttgcc
tggacgcaaaaccgcctgatgctccccgcctggctgggtgcaggtacggcgctgcaaaaa
gtggtcgaagatggcaaacagagcgagctggaagccatgtgccgcgattggccattcttc
tcgacgcgtctcggcatgctggagatggtcttcgccaaagcagacctgtggctggcggaa
tactatgaccaacgcctggtagacaaagcactgtggccgttaggtaaagagttacgcaac
ctgcaagaagaagacatcaaagtggtgctggcgattgccaacgattcccatctaatggcc
gatctgccgtggattgcagagtctattcagctacggaatatttacaccgacccgctgaac
gtattgcaggccgagttactgcaccgctcccgccaggcagaaaaagaaggccaggaaccg
gatcctcgcgtcgaacaagcgttaatggtcactattgccgggattgcggcaggtatgcgt
aataccggctaa