Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.2786 NADP-dependent malic enzyme (EC 1.1.1.40) [Escherichia coli P0299917.4]
atggatgaccagttaaaacaaagtgcacttgatttccatgaatttccagttccagggaaa
atccaggtttctccaaccaagcctctggcaacgcagcgcgatctggcgctggcctactca
ccaggcgttgccgcaccttgtcttgaaatcgaaaaagacccgttaaaagcctacaaatat
accgcgcgcggtaacctggtggcggtgatctctaacggtacggcggtgctggggttaggc
aacattggcgcgctggctggcaaaccggtgatggaaggcaagggcgttctgtttaagaaa
ttcgccgggattgatgtatttgacattgaagttgatgaactcgacccggacaaatttatt
gaagttgtcgctgcgctcgaaccgaccttcggcggaatcaacctcgaagacattaaagcg
ccagaatgtttctatattgaacagaaactgcgcgagcggatgaatattccggtattccac
gacgatcagcacggcacggcaatcatcagcactgccgccatcctcaacggcttgcgcgtg
gtggagaaaaacatctccgacgtgcggatggtggtttccggcgcgggtgccgcagcaatc
gcctgtatgaacctgctggtagcgctgggtctgcaaaaacataacatcgtggtttgcgat
tcaaaaggcgttatctatcagggccgtgagccaaacatggcggaaaccaaagccgcatat
gcggtggtggatgacggcaaacgtaccctcgatgatgtgattgaaggcgcggatattttc
ctcggatgttccggcccgaaagtgctgacccaggaaatggtgaagaaaatggctcgtgcg
ccaatgatcctggcgctggcgaacccggaaccggaaattctgccgccgctggcgaaagaa
gtgcgtccggatgccatcatctgcaccggtcgttctgactatccaaaccaggtcaacaac
gtcctttgcttcccgttcatcttccgtggcgcgctggacgttggcgcaaccgccatcaac
gaagagatgaaactggcggcggtacgcgcgattgcagaactggcccacgccgaacagagc
gaagtggtggcttcagcgtatggcgatcaggatctgagctttggtccggaatacatcatt
ccaaaaccgtttgatccgcgcttgatcgttaagatcgctcctgcggtggcgaaagcggcg
atggagtcgggcgtggcgacgcgtccgattgctgatttcgacgtctacatcgacaagctg
actgagttcgtttacaaaaccaacctgtttatgaagccgattttctcccaggctcgcaaa
gcgccgaagcgcgtagttctgccggaaggggaagaggcgcgcgttctgcatgccactcag
gaactggtaacgctgggactggcgaaaccgatccttatcggtcgtccgaacgtgatcgaa
atgcgcattcagaaactgggcttgcagatcaaagcgggcgttgattttgagatcgtcaat
aacgaatccgatccgcgctttaaagagtactggaccgaatacttccagatcatgaagcgt
cgcggtgtcactcaggaacaggcgcagcgggcgctgatcagtaacccgacagtgatcggc
gcgatcatggttcagcgtggggaagccgatgcaatgatctgcggtacggtgggcgattat
catgaacattttagcgtggtgaaaaatgtctttggttatcgcgatggcgttcacaccgca
ggtgcaatgaacgcgctgctgctgccgagtggtaacacctttattgccgatacctacgtc
aatgacgaaccagacgcagaagagctggcggagatcaccttgatggcggcagaaactgtc
cgtcgttttggtattgagccgcgcgttgctctgttgtcgcactccaactttggttcttct
gactgcccgtcgtcgagcaaaatgcgtcaggcgctggaactggtcagggatcgtgcgcca
gatctgatgattgatggtgaaatgcacggcgatgcagcgctggtggaagcgattcgcaac
gaccgtatgccggacagccctttgaaaggttctgccaatattctggtgatgccgaacatg
gaagctgcccgcattagttacaacttactgcgcgtttccagctcggaaggtgtgactgtc
ggtccggtgctgatgggcgtggcgaaaccggttcacgtgttaacgccgatcgcatcggtg
cgtcgtatcgtcaacatggtggcgctggccgtggttgaagcgcaaacccaaccgctgtaa