Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.2621 D-serine ammonia-lyase (EC 4.3.1.18) [Escherichia coli P0299917.4]
atggaaaacgctaaaatgaactcgctcatcgcccagtatccgttggtaaaggatctggtt
gctcttaaagaaaccacctggtttaatcctggcacgacctcattggctgaaggtttacct
tatgttggcctgaccgaacaggatgttcaggacgcccatgcgcgcttatcccgttttgca
ccctatctggcaaaagcatttcctgaaactgctgccactggggggattattgaatcagaa
ctggttgccattccagctatgcaaaaacggctggaaaaagaatatcagcaaccgatcagc
gggcaactgttactgaaaaaagatagccatttgcccatttccggctccataaaagcacgc
ggcgggatttatgaagtcctggcacacgcagaaaaactggctctggaagcggggttgctg
acgcttgatgatgactacagcaaactgctttctccggagtttaaacagttctttagccaa
tacagcattgctgtgggctcaaccggaaatctggggttatcaatcggcattatgagcgcc
cgcattggctttaaggtgacagttcatatgtctgctgatgcccgggcatggaaaaaagcg
aaactgcgcagccatggcgttacggtcgtggaatatgagcaagattatggtgttgccgtc
gaggaaggacgtaaagcagcgcagtctgacccgaactgtttctttattgatgacgaaaat
tcccgcacgttgttccttgggtattccgtcgctggccagcgtcttaaagcgcaatttgcc
cagcaaggccgtatcgtcgatgctgataaccctctgtttgtctatctgccgtgtggtgtt
ggcggtggtcctggtggcgtcgcattcgggcttaaactggcgtttggcgatcatgttcac
tgcttttttgccgaaccaacgcactccccttgtatgttgttaggcgtccatacaggatta
cacgatcagatttctgttcaggatattggtatcgacaaccttaccgcagcggatggcctt
gcagttggtcgcgcatcaggctttgtcgggcgggcaatggagcgtctgctggatggcttc
tatacccttagcgatcaaaccatgtatgacatgcttggctggctggcgcaggaagaaggt
attcgtcttgaaccttcagcactggcgggtatggccggacctcagcgcgtgtgtgcatca
gtaagttaccaacagatgcacggtttcagcgcagaacaattgcgtaatgccactcatctg
gtgtgggcgacgggaggtggaatggtgccggaagaagagatgaatcaatatctggcaaaa
ggccgttaa