Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116050.3.peg.2610 3-ketoacyl-CoA thiolase (EC 2.3.1.16) @ Acetyl-CoA acetyltransferase (EC 2.3.1.9) [Escherichia coli P0299917.4]
atgggtcaggttttaccgctggttacccgccagggcgatcgtatcgccattgttagcggt
ttacgtacgccttttgcccgccaggggacggcttttcatggcattcccgcggttgattta
gggaagatggtggtaggcgaactgctggcacgcagcgagatccccgctgaagtgattgaa
cagctggtctttggtcaggtcgtacaaatgcctgaagcccccaacattgcgcgtgaaatt
gttctcggtaccggaatgaatgtgcataccgatgcttacagcgtcagccgcgcttgcgct
accagtttccaggcggttgcaaacgtcgcagaaagcctgatggcgggaactatccgagcg
gggattgccggtggggcagattcctcttccgtattgccaattggcgtcagtaaaaaactg
gcgcgcgtgctggttgatgtcaacaaagctcgaaccatgagccagcgcctgaaactcttc
tctcgcctgcgtttgcgcgacttaatgcccgtaccgcctgcggtagcagaatattctact
ggcttgcggatgggcgacaccgccgaacaaatggcgaaaacctacggcatcacccgagaa
cagcaagatgcattagcgcaccgttcgcatcagcgtgccgctcaggcatggtcagacgga
aaactcaaagaagaggtgatgactgcctttatccctccttataaacaaccgcttgtcgaa
gacaacaatattcgcggtaattcctcgcttgccgattacgcaaagctgcgtccggcgttt
gatcgtaaacacggaacggtaacggcggcaaacagtacgccgctgaccgatggcgcggca
gcggggatcctgatgactgaatcccgagcgaaagaattagggctggtgccgctggggtat
ctgcgcagctacgcatttactgcgattgatgtctggcaggacatgttgctcggtccggcc
tggtcaacaccgctggcgctggagcgtgccggtttgacgatgagcgatctgacattgatc
gatatgcacgaagcctttgccgctcagacactggcgaatattcagttgctgggcagcgaa
cgttttgctcgtgaagtactggggcgtgcacatgccactggcgaagtggacgatagcaaa
tttaacgtgcttggcggttcgattgcttacgggcatcccttcgcggcgaccggcgcgcgg
atgattacccagacattgcatgaacttcaccgtcgcggcggtggatttggtttagttacc
gcctgtgctgccggtgggcttggcgcggcaatggttctggaggcggaataa