Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1116007.3.peg.4694 HTH-type transcriptional regulator IlvY [Escherichia coli 2731150]
gtggatttacgcgatctgaaaaccttcctgcatctggcggaaagccgccattttggccgc
agcgcgcgggcgatgcacgttagcccatccacgctctcacggcagattcagcgcctggaa
gaagatctcggtcagccgctgtttgtgcgcgataaccgcacggtgacgctgactgaagcg
ggcgaagagctgcgcgttttctcccagcaaacgctgttgcagtatcagcagttgcgccac
accatcgatcagcaagggccgtcgctctctggcgaattacatatcttctgctcggtgacc
gctgcctacagccatctgccgccgattctggatcgcttccgcgcggaacacccgtcggtg
gagattaaacttactactggtgatgcggcagatgcgatggaaaaggtggtcactggtgaa
gcggatctggcgattgcgggtaaaccggaaaccttgcccggcgcagtggcgttttcgatg
ctggagaatctggcagtagtgctgattgcccccgcgctgccctgcccggtgcgtaatcag
gtgtcggtagagaagccggactggtcaacggtgccgtttattatggccgatcaggggccg
gtacgccgccgcattgaactgtggtttcgacgcaataaaatcagtaacccgatgatttac
gccacggttggcgggcatgaagcgatggtatcgatggtggcactcggctgtggcgtggca
ttgttgccggaagtggtgctggaaaacagccccgaaccggtgcgtaaccgcgtgatgatt
ttagagcgcagcgatgagaaaacgccgtttgagctgggcgtgtgtgcgcagaaaaagcgg
ctacatgagccgctaattgaggcattctggaagattttgccgaaccacaaatga