Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|1074482.3.peg.353 hypothetical protein [Bifidobacterium breve DPC 6330]
atgaaacgtatcccactcaaggacacggaacgctacacgattgaacggttccggcagtgc
aagaagacggaacgtcatctcgcgtggttgaaaagccgtaaggcgggtgtgggcggttcc
gacatgagcacgatcctcggcctgaattccttcaagacaccgtacgaattgtggcttgag
aagaccggccgcgtggaaccggaggacatctcggacaagtgggcgatcgtcaagggcaat
gccttggagaacgagctcaggaagcgtttccgcgccaatcatccggaaatgctcgtcacg
gacggcaccgacaagcagttcatcatgcgcgggaagccatacctgcgcgcttcccttgac
ggcatcctgcaaggtgaggacggaagttttggaatccttgaaatcaaaacggcgagcaac
cgtcgagcgggggactggcatgacgaggacggcagcctccgaatcccaccttattatctc
gcccaagtcgagttctacgcgcttgtaacgggatggacgtggggagtcgtgtacgcggcc
atcggagacgacgagccggtagagattccgttcaaggccgacgtggaggatatgggcgcg
atcgacaaggccgcagccgacttctggcgtttcgtcaccaccggcacgccaccgcaattg
accggcggcgacgtgcagaaggcgttcccggaacccgctccggacatcgtggacgaaagc
gacgacgatgacctctacgacctgctcgcaagatacgagagcacgtccaaccgcgcgaag
gaactgaaaaacgagcagaaggcattgcaggagcagatcatcgtgcgcatcggctcgcat
acgggcgtgcgttgcggcaacctccaagccacctacaagccgacgacccgcaaggaatac
gtcgtcaaagccaccacataccgcaaattcgcattcaaatccaccgaagaaaaggagcaa
taa