Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.4.peg.313 Putative acetyltransferase YvoF [Staphylococcus aureus subsp. aureus COL]
ttgaggaaatttttatcaaaaacacatcatcatacaaaccctttatggcgtgtataccgt
cttgttaaattttcgaaagtttttaagaatgtaattatcattgaattttcgaaatttatt
ccaagtatggtactgaaaagacatatatataaacaacttttaaatattaatatcggtaat
caatcgtcgatagcttataaagtaatgttagatattttttacccagaactgattacgatt
ggtagtaacagtgttattggttacaatgtaacaattttgacgcatgaagcattagttgat
gaatttcgttatggaccagtgacgataggatctaacactttgattggtgcaaatgctacc
attttacccggtataacgattggtgacaatgtaaaagttgcagctggtacggttgtttca
aaagatataccggataatggatttgcatatggcaaccctatgtatataaaaatgattagg
aggtga