Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.874 Hypothetical SAV0788 homolog in superantigen-encoding pathogenicity islands SaPI [Staphylococcus aureus subsp. aureus COL]
aaataacctagatattttttttaccaataacgttcccagaaaagaacgtaaaaacatctt
aaaaggaggtgaattaaatgtctagaacaaaattgcatgatgtaccagctaaagaaaata
caattacagaaccaaagcaagttgtagtgaatcctttgtttgcgaaacctaatgcactag
ctagtatttttggaatttcatatagttcggtgaatcgcattttaaaagaatgggaaaaag
attctaaaggtgttgatgatttatattactcgttatcatcaacaatgattgttataagta
ttccacgattcgaggagtacatgaaggcacgtcataaaaaatggatgtaggaggcaaggc
aatgaaaatgtatttagcttatatctgcttagtttcattgttaacaattttattactagc
aatatctaacatgtatgtcgcttttagcgtttatgcttggctaataactttaggatgtaa
tttaacaggaggattagaaaATGAATAATGAACAAAAAGAAGTAATAGAACACTTGGTTT
ATCAACTTGAGTTAAGTGTCATGAATAATTTGGAAAGTTACGAACACACAGAATATGTTA
ATGGTATTGAAGTGGTTTCAGAGATCAGTCGTGAAAAGCACTTAGAATTGATAATGAAAT
GGTGCGCACAAGAATTAAAGAATAATTTTCAATTAGAGAAAGGAGAATAAaaatgaattg
ggaaattaaagatttaatgtgtgacattgaagtgataaaacaaaaaattaatgatgtagc
taccaaacatgcttggtttgttgaagatagatttgtaaaaaatgaattagaaacaaaacg
ggaacatattaatttttctgctagctatttagaacatcgtatacaaaatgaacatacagt
tgagttattacatgtgtacttaaaagaattcagtgaacttatacaaaaatttcatgaaat
agaaaaagcgtcatcagagaactttgacgaggaatcagatgacgcaaagaattcaataaa
agtagcagagtaatttagaaattacacattcttattataacatctttactctgttgtttc
attagaggtgcaaaaaatgaatgaaattaaattgaaatatgatacgcaagtttcggtggt
acattatgaaagtttagactcacgttcatttaagagcttttcaatgcctaaatggagtaa
gttggttaat