Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.762 Glycine betaine ABC transport system, ATP-binding protein OpuAA (EC 3.6.3.32) [Staphylococcus aureus subsp. aureus COL]
tttaagcaaaaagcgactgaaaaagtatttataaatacggttgaaggggttgaccgagta
ttattcagtcagttggtagaagttcgtaaaaagttaagtgacaaattaacgatagcacct
gtaagtatattttctgattacacgttggaggaatttgctaaacgtaagcctgcttcgaaa
caagatatgattaatattgatggcgtaggtagttacaaattaaaacattattgtccagca
tttttagaaacgattcaaaattataaagccaaagtatagtgaagacacctagtaagcatt
ccttgttttactgggtgtttttttgaattcaaggtaaaataacactatttcttaactgga
gattacctattattcattattttattaaaaaagttcaaggataaatcatttaaatttgaa
aattgtaataaacgtggttaaatagggaatacatacatataatctcggttttatgctatg
agaaaaaaagaggtggcaaaGTGATTAAGTTTAAAAATGTAACTAAGCGTTATGGCAAAC
ATGTTGCTGTCGATAACATTAGTTTCAATATTAATGAGGGTGAATTTTTTGTGCTAATTG
GACCTTCAGGTTGTGGAAAAACTACGACATTAAAAATGATTAATCGACTCATTCACTTAA
GTGAAGGTTATATTTATTTTAAAGATAAACCAATAAGTGATTATCCAGTATACGAAATGC
GTTGGGATATTGGATACGTATTGCAGCAGATTGCATTATTCCCACATATGACAATCAAAG
AAAATATTGCACAAGTGCCACAAATGAAAAAGTGGAAAGAAAAAGATATAGATAAAAGAG
TAGATGAATTACTTGAAATGGTTGGATTAGAACCTGAAAAATATAAAAACAGAAAACCTG
ATGAATTGTCAGGGGGGCAACGACAACGTGTAGGAGTTATACGTGCGTTAGCAGCTGATC
CACCAGTTATTTTAATGGATGAACCGTTTAGTGCATTAGACCCAATCAGCCGAGAAAAAC
TTCAAGATGATTTAATTGAATTACAAACTAAAATTAAGAAGGCAATCATATTTGTTACAC
ATGATATTCAAGAGGCGATGAAACTTGGTGATAAGATTTGTCTTTTGAATGAAGGGCATA
TTGAACAAATTGACACACCAGAAGGATTTAAAAATAATCCTCAAAGTGAATTTGTTAAAC
AATTTATGGGTAGTCATTTAGAAGATGATGCGCCATGTGTTGAAGAGAACGCAATTATCC
GTGACTTGGATATTATGAAACCAATCGATGAGGTTACATCTATGAGCGCTTATCCAATTG
TTTATGACAATCAACCAATTGAAGTATTGTATCAACTTTTATCAGAGAGCGAGCGTGTCA
TTGTCATGCAAGAAGATAGCGTAGGTCAATATGTTATTGATAGGAAAGATATCTTCAAAT
ATTTGTCCCAGAAAAAGGAGGTAGCTCAACATGACTAActttttcgacatattgagtgaa
cgtaaggggcaactcttttcgacaatgatagaacatattcaaatatcatttatcgcatta
ttgattgcaactgctattgcggtaccattaggtattttattaacgaagactaaaacgata
tctgaaatcgtaatgaatattgcggcaattcttcaaaccataccatcgttggcattatta
ggtttaatgattcctttatttggtatcggtcgtgtgccagcaattattgcacttgtagtg
tatgcgttgttaccaattttaaggaatacgtatactggaattaaagaagttgatccatca
ctcattgaagcggctaaaggtataggtatgaaaccatttagacgtttaactaaagtcgaa
cttccgatagcaatgcctgttataatggctggtgtaagaacggctatggtattaattata
ggtacagcaacactagcagcattaattggtgcaggcggactaggagatttaattttat