Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.726 Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family [Staphylococcus aureus subsp. aureus COL]
atgaaaaataataaagatgaaaaaataagaatatccataattaacggatttttgggtagt
ggtaaaaccacgttactgacacattatattagtgaattattaaaaaatgatgagaaaatt
aaaatcatcatgaatgaattcggtacttttgatattgatagcaatagtatttcaaatgaa
attgaagtccattcattgattaatggttgtgtttgttgcgatcttaaacaagaacttgtc
tatgaactaaaagccattgctttaaaaggggacgttaatcatgtcatcatagaagcgaca
ggcattgcgcatcctttggaattactagttgcatgtcaagatccgcaaatcgttaatttc
tttgaaaagccgattatttatggtgtattagatgcgactcgatttttagaacgtcatcaa
tataccgaaaatacagtttcgctgatggaagatcagttgaaactaagtgacatgattatt
attaataaaattgatcttataactgatgacagtcttgagaaaattgataagcaattaggt
atgatttgtgcaagtattccaacttataaaacaacctatggaaaagtttcgttggaagaa
ttggacttaactgttaaagacagagagatatcgtctcatcatcaccatcatcatgggatt
aaaagtatgacttacacgtttacaggtccgattgatcgtcatttgttttatcaatttata
atgaaattaccggaatctgttctacgtttgaaaggttatgtgtcatttagagatcaacca
aatgcaatttatgaatttcaatatgcatatggtttaccagactatggaataattggcatg
caattaccattaacgattgttattattggtgaaactttagatacaaatcacatacgtaat
caattggatatgctacaatttacgtaa