Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.291 Repetitive hypothetical protein near ESAT cluster, SA0282 homolog [Staphylococcus aureus subsp. aureus COL]
atgactttcgaagaaaaactaagtcaaatgtacaatgaaattgcaaatgaaatcagtgga
atgataccagttgaatgggaaaatatatatacaattgcctatgtaactgatcaaggtgga
gaggtcatttttaattatactaaaccaggtagcgatgaattgaattattacacatatatc
cctagagagtataatgtctctgaaaaagtattttatgatttgtggacggatttatataga
ttgtttaagaagttaagagaaacttttaaagaagaagggcttgaaccatggacatcaagt
gaatttgactttacaagcgaaggtaaattaaaagtttcatttgattatattgattggata
aatacagagtttgatcaattaggccgtgaaaactattatatgtataaaaagtttggtgtt
ttaccagaaatggaatacgaaatggaagaagttaaagaaatcgagcaatatattaaagag
caagatgaagctgaactatag