Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.2543 3-methyl-2-oxobutanoate hydroxymethyltransferase (EC 2.1.2.11) [Staphylococcus aureus subsp. aureus COL]
ttgaaaacagtaagtcaattaatagatatgaaacaaaaggaaactaaaatttctatggta
acagcttatgattttccaagtgctaaacaagtggaagcagcgggtattgatatgattctt
gttggggattcacttggtatgactgtattaggttatgaaagtaccgtacaagtgacgtta
gcagatatgattcatcacggtcgtgcagtaagaagaggcgcaccaaatacatttgtagtt
gttgatatgccgattggtgcagtaggcatctctatgacacaagacttaaatcatgctcta
aagctttatcaggagacgaatgcaaatgcaattaaagcagaaggagcgcatattacacca
tttattgaaaaagcaacggcaattggtattcctgttgttgcacatttaggattaacacct
caaagtgttggcgttatggggtataaattacaaggtgcaacgaaagaagcagcggagcaa
cttattttagacgcgaaaaatgtagaacaagctggtgcagttgcgttagtacttgaagca
attccaaatgatttagcagaagaaattagcaagcacttaacaattccagtcattggtatt
ggtgcaggaaaaggtacagatggtcaagtattggtttatcacgatatgttaaattatggt
gttgaacataaagcgaaatttgtgaagcaatttgctgattttagtgttggtgtggatggt
ttaaaacaatacgatcaagaagttaaatctggtgcatttccatcagaagaatatacgtat
aaaaagaaaattatgaatgaggttaataacaatgactaa