Display fasta sequences

DNA Sequence: DNA Sequence with flanking: bases Protein Sequence

>fig|93062.19.peg.1916 Aspartyl-tRNA(Asn) amidotransferase subunit C (EC 6.3.5.6) @ Glutamyl-tRNA(Gln) amidotransferase subunit C (EC 6.3.5.7) [Staphylococcus aureus subsp. aureus COL]
atgacaaaagtaacacgtgaagaagttgagcatatcgcgaatcttgcaagacttcaaatt
tctcctgaagaaacggaagaaatggccaacacattagaaagcattttagattttgcaaaa
caaaatgatagcgctgatacagaaggcgttgaacctacatatcacgttttagatttacaa
aacgttttacgtgaagataaagcaattaaaggtattccacaagaattagctttgaaaaat
gccaaagaaacagaagatggacaatttaaagtgcctacaatcatgaatgaggaggacgcg
taa